View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15285_high_3 (Length: 282)
Name: NF15285_high_3
Description: NF15285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15285_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 30403302 - 30403036
Alignment:
| Q |
1 |
aaagacgcttacgtgttgaaatagtttggttgtataaatagagactgtattcataattgtcttgaatttaattgtgaaagagggtctaacg-caaacttt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30403302 |
aaagacgcttacgtgttgaaatagtttggttgtataaatggagactgtattcataattgtcttgaatttaattgtgaaagagggtctaacgtcaaacttt |
30403203 |
T |
 |
| Q |
100 |
tagattgcatgtgttgagcaacgaaacattgaattcgagggttttgtctgccagatatacaaatgagatgaaactcaacatacttaatcttaaatcctgt |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30403202 |
tagattgcatgcgttgagcaacgaaacattgaatttgagggttttgtctgccagatatacaaatgagatgaaactcaacatacttaatcttaaaccctgt |
30403103 |
T |
 |
| Q |
200 |
gctaataaataagaaaacatttgaagagctagagatacaagataaatatgttgccaagttagaaaag |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30403102 |
gctaataaataagaaaacatttgaagagctagagatacaagataaatatgttgccaagttagaaaag |
30403036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University