View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15285_high_9 (Length: 205)
Name: NF15285_high_9
Description: NF15285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15285_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 12912450 - 12912282
Alignment:
| Q |
18 |
tgtatgaagttacaagttttgcatatacatatatggtaaattacacaaattttaccgtggtctattttaatacatggtataaatttggctccgttacggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12912450 |
tgtatgaagttacaagttttgcatatacatatatggtaaattacacaaattttaccgtggtctattttaatacatggtataaatttggctccgttacggt |
12912351 |
T |
 |
| Q |
118 |
tacactatagaaaaataannnnnnngatcatggccttttgtggtttgatgtagccgttgcgttcagtat |
186 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12912350 |
tacactagagaaaaataatatttgtgatcatggccttttgtggtttgatgtagccgttgtgttcagtat |
12912282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University