View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15285_low_6 (Length: 240)
Name: NF15285_low_6
Description: NF15285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15285_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 222
Target Start/End: Original strand, 5257024 - 5257236
Alignment:
| Q |
10 |
agcaaaggtagaattcacatttctctctaacatttcagcatactaatagggtttcaaataaaggtctgcgatcgcaacgtgagctgcaacacaacactat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5257024 |
agcaaaggtagaattcacatttctctctaacatttcagcatacaaatagggtttcaaataaaggtctgcgatcgcaacgtgagctgcaacacaacacttt |
5257123 |
T |
 |
| Q |
110 |
tttatgttgtcaaacccgcaatgcgactgcaattgaggccccattggccgtattttattgtgattctccgtaatatcaagaatcacaacatagctgcaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5257124 |
tttatgttgtcaaacccgcaatgcgactgcaattgaggccccattggccgtattttattgtgattctccgtaatatcaagaatcgcaacatagctgcaac |
5257223 |
T |
 |
| Q |
210 |
tgctaccgcgact |
222 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
5257224 |
tgctaccacgact |
5257236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University