View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15285_low_9 (Length: 222)
Name: NF15285_low_9
Description: NF15285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15285_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 6445470 - 6445656
Alignment:
| Q |
17 |
taggtgagttagtcagaccatgatgatttagttccgttgaatttctaaggatctgtgaaccagaaaggtattatttgcaatagataatggcaaatgcaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6445470 |
taggtgagttagtcagaccatgatgatttagttccgttgaatttctaaggatctgtgacctagaagggtattatttgcaatagataatggcaaatgcaaa |
6445569 |
T |
|
| Q |
117 |
catgttcttgggaatcttggcaagtcacaatgttaatcgaactcaatnnnnnnnntaaaataaatcaacaatgatatatgtacctccaat |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6445570 |
catgttcttgggtatcttggcaagtcacaatgttaatcgaactcaat---aaaaataaaataaatcaacaatgatatatgtacctccaat |
6445656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University