View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15287_high_3 (Length: 318)
Name: NF15287_high_3
Description: NF15287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15287_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 36095704 - 36095610
Alignment:
| Q |
1 |
cacttcaaacatcataactcgaatccttgatcttttgggtgtaaatgaagtgtttaaccaactaaattgcactttgctaacaaatttatgaatgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36095704 |
cacttcaaacatcataactcgaatccttgatcttttgggtgtaaatgaagtgtttaaccaactaaattgcactttgctaacaaatttatgaatgt |
36095610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 232 - 318
Target Start/End: Complemental strand, 36095473 - 36095381
Alignment:
| Q |
232 |
cttaccggaaatgatgggttacatggacgatat------tgatatgaatatagagattttagtcttaatcgtgtttttggcatttggtaaaaa |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
36095473 |
cttaccggaaatgatgggttacatggacgatatcgatattgatatgaatatagagattttagggttaatagtgtttttggcatttggtaaaaa |
36095381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University