View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15289_high_19 (Length: 325)
Name: NF15289_high_19
Description: NF15289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15289_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 38 - 256
Target Start/End: Complemental strand, 8016778 - 8016563
Alignment:
| Q |
38 |
ctctacctcttcttcaccatgttgctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaactta |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016778 |
ctctacctcttcttcaccatgttgctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaactta |
8016679 |
T |
|
| Q |
138 |
tgtccacactcttccctccgggtatgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttattat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016678 |
tgtccacactcttccctccgggtatgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttat--- |
8016582 |
T |
|
| Q |
238 |
tattgacatgatgatgatg |
256 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8016581 |
tattgacatgatgatgatg |
8016563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University