View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1528_low_12 (Length: 320)
Name: NF1528_low_12
Description: NF1528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1528_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 24 - 224
Target Start/End: Original strand, 3598279 - 3598479
Alignment:
| Q |
24 |
tgttgccgagaatcctgtaaaccaggccactcctactacagaaaatcctataagcaatcaagcaggtggggcagaaaatcctgtaaatgttgcaaaagac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3598279 |
tgttgccgagaatcctgtaaaccaggccactcctactacagaaaatcctataagcaatcaagcaggtggggcagaaaatcctgtaaatgttgcaaaagac |
3598378 |
T |
|
| Q |
124 |
caagcagttggtgcagaaaaccccgtaaatgacactttaggtggttcggatgttttagtgagtgataaagcacatgctgccgaaaattctataaatgata |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3598379 |
caagcagttggtgcagaaaaccccgtaaatgacactttaggtggttcggatgttttagtgaatgataaagcacatgctgccgaaaattctataaatgata |
3598478 |
T |
|
| Q |
224 |
c |
224 |
Q |
| |
|
| |
|
|
| T |
3598479 |
c |
3598479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University