View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1528_low_20 (Length: 264)
Name: NF1528_low_20
Description: NF1528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1528_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 141 - 223
Target Start/End: Complemental strand, 30286027 - 30285945
Alignment:
| Q |
141 |
gatgatgatggttttgtctagatgttgatgactctccttgttcaaaatgaattggttctgcaagaacaatctctgccatttct |
223 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30286027 |
gatgatgttggttttgtctagatgttgatgactctccttgttcaaaatgaattggttctgcaagaacaatctctgccatttct |
30285945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 21 - 87
Target Start/End: Complemental strand, 30286141 - 30286075
Alignment:
| Q |
21 |
tatcatagggacctggttgaaggtgttcatcattgctgctgctactaacactattggtagtaatagc |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30286141 |
tatcaaagggacctggttgaaggtgttcatcattgctgctgctgctaacactattggtagtaatagc |
30286075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University