View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1528_low_22 (Length: 201)
Name: NF1528_low_22
Description: NF1528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1528_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 5 - 116
Target Start/End: Original strand, 42678608 - 42678719
Alignment:
| Q |
5 |
ctccacaataaagactccattgacatgctccgccgtcagggtatcgacttctttcgtaacactgttcaaggtgtggactcgtttcattttgcgatgctga |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42678608 |
ctccacaacaaagactccattgacatgctccaccgtcagggtatcaacttctttcgtaacactgttcaaggtgtggactcgtttcattttgcgatgctga |
42678707 |
T |
 |
| Q |
105 |
tgcggtggtctg |
116 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42678708 |
tgcggtggtctg |
42678719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 54704130 - 54704090
Alignment:
| Q |
15 |
aagactccattgacatgctccgccgtcagggtatcgacttc |
55 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
54704130 |
aagattccattgacatgctccgccgtcaaggtattgacttc |
54704090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University