View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1528_low_4 (Length: 269)
Name: NF1528_low_4
Description: NF1528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1528_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 8 - 255
Target Start/End: Complemental strand, 2466946 - 2466699
Alignment:
| Q |
8 |
attattctctctgttgattaccggttagcaccggagcatcgtcttccaatagcttatgaagattgttactcatcacttgaatggcttggtgaaaatgtga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466946 |
attattctctctgttgattaccggttagcaccggagaatcgtcttccaatagcttatgaagattgttactcatcacttgaatggcttggtgaaaatgtga |
2466847 |
T |
|
| Q |
108 |
aaaccgaaccgtttctacgacatgctgatttatcaaatgtttttctctctggtgatagtgctggtggtaacatttctcattatgttgctgttaaagctat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466846 |
aaaccgaaccgtttctacgacatgctgatttatcaaatgtttttctctctggtgatagtgctggtggtaacatttctcattatgttgctgttaaagctat |
2466747 |
T |
|
| Q |
208 |
tcaaaatgatgggttttgtcctgtgaagattaaaggggttatacttat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2466746 |
tcaaaatgatgggttttgtcctgtgaagattaaaggggttatgcttat |
2466699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University