View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1528_low_9 (Length: 399)

Name: NF1528_low_9
Description: NF1528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1528_low_9
NF1528_low_9
[»] chr8 (3 HSPs)
chr8 (13-107)||(35629109-35629208)
chr8 (174-254)||(35628961-35629042)
chr8 (247-277)||(35628745-35628775)


Alignment Details
Target: chr8 (Bit Score: 72; Significance: 1e-32; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 13 - 107
Target Start/End: Complemental strand, 35629208 - 35629109
Alignment:
13 aatatgacagttggaagtgacaatgtattgtccttctatagttcttttgttttcttcttaatttcaaata-----atccgtatctgtttacgtgatagtg 107  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||     ||||||||| |||||||||||||||    
35629208 aatatgacagttggaagtgacaatgtattgtccttctataattcttttgttttcttcttaatttcaaataatccaatccgtatcagtttacgtgatagtg 35629109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 174 - 254
Target Start/End: Complemental strand, 35629042 - 35628961
Alignment:
174 gtactgtactatctcttccttcatagtttgacttacagatgttaaatcaatattgtgc-atatgatgtcaattaatatgaat 254  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
35629042 gtactgtactatctcttccttcatagtttgacttacatatgttaaatcaatattgtgcaatatgatgtcaattaatatgaat 35628961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 247 - 277
Target Start/End: Complemental strand, 35628775 - 35628745
Alignment:
247 atatgaatttgagtttggagagtactgacaa 277  Q
    |||||||||||||||||||||||||||||||    
35628775 atatgaatttgagtttggagagtactgacaa 35628745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University