View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15290_high_3 (Length: 271)
Name: NF15290_high_3
Description: NF15290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15290_high_3 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 43526235 - 43526505
Alignment:
| Q |
1 |
atgttgagagaagaagacacgaggagatgcgtgttgcggctgtaaagtgaaaaaggcaacatgtttctagggtttcaattagtttatgtgggtttgggcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43526235 |
atgttgagagaagaagacacgaggagatacgtgttgcggctgtaaagtgaaaaaggcaacatgtttctagggtttcaactagtttatgtgggtttgggcc |
43526334 |
T |
|
| Q |
101 |
aaaagaatgtcactaatgtatagttatttatatggtatccggtttaaccggttctataacggttcaaccggttagatcgattgaaccataaaccagaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43526335 |
aaaagaatgtcactaatgtatagttatttatatggtatccggtttaaccggttctataacggttcaaccggttaaatcgattgaaccataaaccagaggt |
43526434 |
T |
|
| Q |
201 |
cataccagttcgatctccggtccggttttcaaaacattggtcacaacaatatttacgaacatgtgtttttt |
271 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43526435 |
cataccggttcgatctccggtccggttttcaaaacattggtcacaacaatatttacgaacatgtgtttttt |
43526505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 239
Target Start/End: Original strand, 3742816 - 3742918
Alignment:
| Q |
137 |
atccggtttaaccggttctataacggttcaaccggttagatcgattgaaccataaaccagaggtcataccagttcgatctccggtccggttttcaaaaca |
236 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||| || | |||||||| |||| |||||| | | |||||||||| ||||||||||| |||||| |
|
|
| T |
3742816 |
atccggtttaatcggttctataatggtttaaccggttggaccatttgaaccaagaaccgaaggtcacaacggttcgatctctggtccggttttaaaaaca |
3742915 |
T |
|
| Q |
237 |
ttg |
239 |
Q |
| |
|
||| |
|
|
| T |
3742916 |
ttg |
3742918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 239
Target Start/End: Complemental strand, 11342776 - 11342697
Alignment:
| Q |
160 |
cggttcaaccggttagatcgattgaaccataaaccagaggtcataccagttcgatctccggtccggttttcaaaacattg |
239 |
Q |
| |
|
|||||||| ||||| | |||||||||||| |||| ||||||| ||| ||| ||||||||||| |||||| ||||||||| |
|
|
| T |
11342776 |
cggttcaaacggttcaaccgattgaaccatgaaccggaggtcacacctgtttgatctccggtctggttttgaaaacattg |
11342697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 46525624 - 46525712
Alignment:
| Q |
151 |
gttctataacggttcaaccggttagatcgattgaaccataaaccagaggtcataccagttcgatctccggtccggttttcaaaacattg |
239 |
Q |
| |
|
|||||||||||||||||| | ||| | | ||||||||| |||| ||| || |||| ||| ||||| |||||| |||||||||||||| |
|
|
| T |
46525624 |
gttctataacggttcaactgattaaactggttgaaccatgaaccggagatcttaccggtttgatctttggtccgattttcaaaacattg |
46525712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University