View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15290_low_2 (Length: 273)
Name: NF15290_low_2
Description: NF15290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15290_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 44 - 258
Target Start/End: Original strand, 43526509 - 43526723
Alignment:
| Q |
44 |
tagagaaaacaagtgtatttctttggtcttaaaataatttgtttgttaatttttaatatacatttgccatacattaagctaaaattataaaaggtagata |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43526509 |
tagagaaaacaagtgtatttctttggtcttaaaataatttgtttgttaatttttaatatacatttgccatacattaagctaaaattataaaaggtagata |
43526608 |
T |
|
| Q |
144 |
gacaataaactatgacagctatcttttgcaattgaattttctttctatcagaagtagtacaaaagtaacacaaatctctcttcacatttattcggccgag |
243 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43526609 |
gacaataaactatgacagttatcttttgcaattgaattttctttctatcagaagtagtacaaaagtaacacaaatctctcttcacatttattcggccgag |
43526708 |
T |
|
| Q |
244 |
gttgcctgttcaaat |
258 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43526709 |
gttgcctgttcaaat |
43526723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University