View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15291_high_5 (Length: 238)

Name: NF15291_high_5
Description: NF15291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15291_high_5
NF15291_high_5
[»] chr5 (1 HSPs)
chr5 (1-221)||(12617372-12617592)


Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 12617372 - 12617592
Alignment:
1 ctttcactttcaccacttaacctctttgatgaaccttcaccttgagaacaatcttgttcttgattcatatgcataacattaacatcatcaacattcaaaa 100  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12617372 ctttcactttcacctcttaacctctttgatgaaccttcaccttgagaacaatcttgttcttgattcatatgcataacattaacatcatcaacattcaaaa 12617471  T
101 caccactttgaaatgaatgatccatagaaaacgatcttcgaattgattcatgataatcttcattatgatctctaatctcaatcacagtatgccttcctct 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
12617472 caccactttgaaatgaatgatccatagaaaacgatcttcgaattgattcatgataatcttcattatgatctctaatctcaatcacactatgccttcctct 12617571  T
201 taaatttcctaaatcacttaa 221  Q
    |||||||||||||||||||||    
12617572 taaatttcctaaatcacttaa 12617592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University