View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15291_low_4 (Length: 327)

Name: NF15291_low_4
Description: NF15291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15291_low_4
NF15291_low_4
[»] chr7 (1 HSPs)
chr7 (1-62)||(4499382-4499443)


Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 4499443 - 4499382
Alignment:
1 tgaccaaaccaattatgaacagcaccccattttttcatcaccataacttgcaacataattgc 62  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
4499443 tgaccaaaccaattatgaacagcaccccattttttcatcacaataacttgcaacataattgc 4499382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University