View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15291_low_5 (Length: 268)
Name: NF15291_low_5
Description: NF15291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15291_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 257
Target Start/End: Original strand, 21100444 - 21100681
Alignment:
| Q |
20 |
catgtgagacttgatttctgaccaagccgaggatttgaaattatgctgaaatggcctaccatttttaaagaaccgatgtctagacgtccaataaggttga |
119 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21100444 |
catgtgagacttgattcctgatcaagccgaggatttgaaattatgctgaaatggcctaccatttttaaagaaccgatgtctagacgtccaatcaggttga |
21100543 |
T |
 |
| Q |
120 |
gggtcttcggataaaagctttcatcccaaatgaaaaattaaggactcgttgacaaaacgtactggcttaagatctaaaccgcccacttcccaatgaaggc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21100544 |
gggtcttcggataaaagctttcatcccaaatgaaaaattaaggactcgttgaaaaaacatattggcttaagatctaaaccgcccacttcccaatgaaggc |
21100643 |
T |
 |
| Q |
220 |
aaacacacttccagtatactgtgcaaacttttagtata |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21100644 |
aaacacacttccagtatactgtgcaaacttctagtata |
21100681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University