View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15293_low_3 (Length: 288)

Name: NF15293_low_3
Description: NF15293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15293_low_3
NF15293_low_3
[»] chr4 (1 HSPs)
chr4 (16-273)||(24320334-24320590)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 16 - 273
Target Start/End: Original strand, 24320334 - 24320590
Alignment:
16 atagagtaagatgggttttgaagcggaccatcctgattggtggtcgatggtggtttggtacttaaaaatcacctaaaacatcgattgataatgtttctta 115  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||    
24320334 atagagtaagatgggttttcaagcggaccatcctgattggtggtcgatggtggtttggtacttaaaaatcacctaaaatatcgattgacaatgtttctta 24320433  T
116 aaagtagaagttcacg-----tttttgatctttatgactgaaacgtcgattcgatagaaatgaggaaaaattaa-gggtaataggtgagtcttatgcact 209  Q
    ||||||||||||||||     || ||||||||||||| ||||||||||||| ||| |||||||||||||||||| ||||||||| |||||||||||||||    
24320434 aaagtagaagttcacgtgtccttcttgatctttatgattgaaacgtcgattagatcgaaatgaggaaaaattaatgggtaatagatgagtcttatgcact 24320533  T
210 tatattggtttcctcttaactttgtcaacagtgatcacctctcaactgggaaaactgagaacta 273  Q
    |||||| |||||||||| ||||||||       |||||||||||||||||||||||||||||||    
24320534 tatattcgtttcctcttgactttgtc-------atcacctctcaactgggaaaactgagaacta 24320590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University