View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15293_low_3 (Length: 288)
Name: NF15293_low_3
Description: NF15293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15293_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 16 - 273
Target Start/End: Original strand, 24320334 - 24320590
Alignment:
| Q |
16 |
atagagtaagatgggttttgaagcggaccatcctgattggtggtcgatggtggtttggtacttaaaaatcacctaaaacatcgattgataatgtttctta |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
24320334 |
atagagtaagatgggttttcaagcggaccatcctgattggtggtcgatggtggtttggtacttaaaaatcacctaaaatatcgattgacaatgtttctta |
24320433 |
T |
|
| Q |
116 |
aaagtagaagttcacg-----tttttgatctttatgactgaaacgtcgattcgatagaaatgaggaaaaattaa-gggtaataggtgagtcttatgcact |
209 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| ||||||||||||| ||| |||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
24320434 |
aaagtagaagttcacgtgtccttcttgatctttatgattgaaacgtcgattagatcgaaatgaggaaaaattaatgggtaatagatgagtcttatgcact |
24320533 |
T |
|
| Q |
210 |
tatattggtttcctcttaactttgtcaacagtgatcacctctcaactgggaaaactgagaacta |
273 |
Q |
| |
|
|||||| |||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24320534 |
tatattcgtttcctcttgactttgtc-------atcacctctcaactgggaaaactgagaacta |
24320590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University