View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15293_low_5 (Length: 204)
Name: NF15293_low_5
Description: NF15293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15293_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 22102188 - 22102383
Alignment:
| Q |
1 |
gtttaattctcttaatgcaaatgaccagagaccagatttatgtacatgagaattgatatgcattgaattaaagtatattctaaataagttcatcttttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22102188 |
gtttaattctcttaatgcaaatgaccagagaccagagtaatgtacatgagaattgatatgcattaaattaaagtatattctaaataagttcatcttttta |
22102287 |
T |
 |
| Q |
101 |
tacctaatttaagacatctgtgtcaattgtcaaattcaattacttctctagttcattcatttataatgcatgaatctgctcgcattagccctatgc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
22102288 |
tacctaatttaagacatctgtgtcaattgtcaaattcaattacttctctagttcattcatttataatgcatgaatctgctggcattagccttatgc |
22102383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University