View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15295_high_7 (Length: 215)

Name: NF15295_high_7
Description: NF15295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15295_high_7
NF15295_high_7
[»] chr8 (1 HSPs)
chr8 (1-199)||(44299169-44299367)


Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 44299169 - 44299367
Alignment:
1 tctggcatcacgtgcatgtaaccggtagcgagtataacaccggaggcaaaagccttaacgatcacgaataaatctccgtcgggttttaacgctgggatcg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||    
44299169 tctggcatcacgtgcatgtaaccggtagcgagtataacaccggaggcaaaagccttaatgatcacgaataaatctccgtcgggttttaatgctgggatcg 44299268  T
101 aagttgtgaaaattggaatacaaattccaatcatgctcgtcactaatatggaaaatattgcaattaattttagctttagtgcttcatttttgttgtgac 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44299269 aagttgtgaaaattggaatacaaattccaatcatgctcgtcactaatatggaaaatattgcaattaattttagctttagtgcttcatttttgttgtgac 44299367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University