View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15295_low_1 (Length: 649)
Name: NF15295_low_1
Description: NF15295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15295_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 576; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 576; E-Value: 0
Query Start/End: Original strand, 14 - 634
Target Start/End: Complemental strand, 36534297 - 36533677
Alignment:
| Q |
14 |
atcaaagagcaggcagaaaacctgaaaggaaggagcaaaaggtagatggcgacagggctcctggacagaggaagaattggcgcagcggtgataataacag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534297 |
atcaaagagcaggcagaaaacctgaaaggaaggagcaaaaggtagatggcgacagggctcctggacagaggaagaattggcgcagcggtgataataacag |
36534198 |
T |
|
| Q |
114 |
taataataaccggagaaacccgagggaaactgacaggcagcaagctcctgagaggcaaccttcacctgaaacatggcgtaagcctgtggaatcatctcaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534197 |
taataataaccggagaaacccgagggaaactgacaggcagcaagttcctgagaggcaaccttcacctgaaacatggcgtaagcctgtggaatcatctcaa |
36534098 |
T |
|
| Q |
214 |
ggtgctggtggcccacgctacggtagagcagcttcagccgttgaacttgcccaagcattctctaaatctgtgtcagatcccaaagtaaataatgatagat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534097 |
ggtgctggtggcccacgctacggtagagcagcttcagccgttgaacttgcccaagcattctctaaatctgtgtcagatcccaaagtaaataatgatagat |
36533998 |
T |
|
| Q |
314 |
tttcaggccaaaggggtttgaacactggcaggatgcaagtgcccttttcacggcttgttggtcccacttcaaggcctcagatcaatggttattaagtctt |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36533997 |
tttcaggccaaaggggtttgaacactggcaggacgcaagtgcccttttcacgtcttgttggtcctacttcaaggccccagatcaatggttattaagtctt |
36533898 |
T |
|
| Q |
414 |
tggtggaaaattgggactcattagagacctttgnnnnnnncatcttggagacagcatttgcttcatgcaaactgtggaattgctgaacattccatggagt |
513 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36533897 |
tggtggaaaattgggactcattcgagacctttgtttttttcatcttggagacagcatttgcttcatgcaaactgtggaattgctgaacattccatggagt |
36533798 |
T |
|
| Q |
514 |
gattgtagtttaacttatttttctctctttcattagcatgagtgagagaattaaaactgctgctagttgcaatgcatttattatgacgatgtctatttac |
613 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36533797 |
gattgtagtttaacttatttttctctctttcattagcatgagtgagagaattaaaactgctgctagttgcaatgcatttattatgacgatgtctatttac |
36533698 |
T |
|
| Q |
614 |
aatcgccatgttgtttttctt |
634 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36533697 |
aatcgccatgttgtttttctt |
36533677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University