View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_high_16 (Length: 454)
Name: NF15296_high_16
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 1 - 441
Target Start/End: Complemental strand, 2226689 - 2226249
Alignment:
| Q |
1 |
ctctcttgaagaagaaacaccgcgaatcaacctacgaacggcatatcggacggaaggagcacattcatctagcccatcatttttctcagcttcaagctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2226689 |
ctctcttgaagaagaaacaccgcgaatcaacctacgaaaggcatatcggacggaaggagcacattcatctagcccatcatttttctcagcttcaagctta |
2226590 |
T |
 |
| Q |
101 |
aaaccaccaaccccatcaatctccatcccttgacctccctcataagccttctgaacttccttcaactcattcaccatttgtttcaccgcagcttccctaa |
200 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2226589 |
aaaccaccatcaccatcaatctccatcccttgacctccctcataagccttctgaacttccttcaactcattcaccatttgtttcaccgcagcttccctaa |
2226490 |
T |
 |
| Q |
201 |
ccgattcattcaccgccgctaaatccttaaacacaccaatatgaaactccggcagcgaatcaccgccactaccgccgccgctagttgaatccaccaaaat |
300 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2226489 |
ccgattcattcaccgctgctaaatccttaaacacaccaatatgaaactccggcagcgaatcaacgccactaccgccgccgctagttgaatccaccaaaat |
2226390 |
T |
 |
| Q |
301 |
agccgaatccggtgctggaagttcggatttagatttggatttagcgctgcgtctttgtttatcgaaagctttgcttttcttatgattttccattgttggt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2226389 |
agccgaatccggtgctggaagttcggatttagatttggatttagcgctgcgtctttgtttatcgaaagctttgcttttcttatgattttccattgttggt |
2226290 |
T |
 |
| Q |
401 |
ttggttgaagatggtgtagcggtggaatcatcgttgttctt |
441 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2226289 |
ttggttgaagatggtgtagcggtggaatcatcgttgttctt |
2226249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University