View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_high_37 (Length: 302)
Name: NF15296_high_37
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_high_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
| [»] scaffold0562 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
| [»] chr1 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 14 - 302
Target Start/End: Original strand, 45388334 - 45388621
Alignment:
| Q |
14 |
gatgaagaaatatagtacaagtaatgttttttgatatatgataaaggtgaatgatgtcataacacccgaacaacagcgagttggagttaccacccgatag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45388334 |
gatgaagaaatatagtacaagtaatgttttttgatatatgataaaggtgaatgatgtcataacacccgaacaacagcgagttggagttaccacccgatag |
45388433 |
T |
 |
| Q |
114 |
attcagggattatgaaccgagaaagatatgacgtttttaaggggcacaagaacaattaaaatggccaatataacaattttctgcgtatgataacatggtc |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45388434 |
attcagggattatgaaccgagagagatatgacgtttttaaggggcacaagaacaattaaaatggccaatataacaattttctgcgtatgataacatggtc |
45388533 |
T |
 |
| Q |
214 |
agtccaatatattttaacagtatgagatatctttagactacatatgaagtatttagtttataaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
45388534 |
agtccaatatattttaacagtatgagatat-tttagactacatatgaagtatttagtttataaaatctaaggttaaatatgtttttggt |
45388621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 271 - 302
Target Start/End: Complemental strand, 48154541 - 48154510
Alignment:
| Q |
271 |
ttataaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48154541 |
ttataaaatttagggttaaatatgtttttggt |
48154510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 272 - 302
Target Start/End: Original strand, 40713886 - 40713916
Alignment:
| Q |
272 |
tataaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40713886 |
tataaaatttagggttaaatatgtttttggt |
40713916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 264 - 302
Target Start/End: Complemental strand, 20977803 - 20977765
Alignment:
| Q |
264 |
atttagtttataaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20977803 |
atttactttataaattttagggttaaatatgtttttggt |
20977765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 273 - 302
Target Start/End: Original strand, 3729 - 3758
Alignment:
| Q |
273 |
ataaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3729 |
ataaaatttagggttaaatatgtttttggt |
3758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 273 - 302
Target Start/End: Original strand, 3872910 - 3872939
Alignment:
| Q |
273 |
ataaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3872910 |
ataaaatttagggttaaatatgtttttggt |
3872939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 273 - 302
Target Start/End: Original strand, 29134046 - 29134075
Alignment:
| Q |
273 |
ataaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29134046 |
ataaaatttagggttaaatatgtttttggt |
29134075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 274 - 302
Target Start/End: Original strand, 27277542 - 27277570
Alignment:
| Q |
274 |
taaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27277542 |
taaaatttagggttaaatatgtttttggt |
27277570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 273 - 302
Target Start/End: Complemental strand, 17935227 - 17935198
Alignment:
| Q |
273 |
ataaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17935227 |
ataaaatttagggttaaatatgtttttggt |
17935198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 273 - 302
Target Start/End: Original strand, 28868000 - 28868029
Alignment:
| Q |
273 |
ataaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28868000 |
ataaaatttagggttaaatatgtttttggt |
28868029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 274 - 302
Target Start/End: Complemental strand, 22888253 - 22888225
Alignment:
| Q |
274 |
taaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22888253 |
taaaatttagggttaaatatgtttttggt |
22888225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 274 - 302
Target Start/End: Complemental strand, 32267013 - 32266985
Alignment:
| Q |
274 |
taaaatttagggttaaatatgtttttggt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32267013 |
taaaatttagggttaaatatgtttttggt |
32266985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University