View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_high_43 (Length: 265)
Name: NF15296_high_43
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 19 - 163
Target Start/End: Original strand, 23431293 - 23431450
Alignment:
| Q |
19 |
actatagtttcattcattttgtctccattaaggtatacttcttcttaccctttttcttctctttcccttaattaaaccattttctagcttgctttcattt |
118 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23431293 |
actatagtctcattcattctgtctccattaaggtacacttcttcttaccctttttcttctctttcccttaattaaaccattttctagcttgctttcattt |
23431392 |
T |
 |
| Q |
119 |
aaaa-------------tgatgattttagtttattttcaatccattcataaaatatgc |
163 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23431393 |
aaaaaaaaacccatttttgatgattttagtttattttcaatccattcataaaatatgc |
23431450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University