View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_high_49 (Length: 250)
Name: NF15296_high_49
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_high_49 |
 | |
|
| [»] scaffold0137 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0137 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: scaffold0137
Description:
Target: scaffold0137; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 5115 - 5044
Alignment:
| Q |
1 |
ctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattattttgtcttacaaggctgcacagg |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5115 |
ctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattatcttgtcttacaaggctgcacagg |
5044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0137; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 166 - 232
Target Start/End: Complemental strand, 4953 - 4887
Alignment:
| Q |
166 |
gttgtgattgtttgaaggatattgctacggcggatcttcgatcttctcatcctataagattgggttt |
232 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4953 |
gttgtgattgtttgaaggatattgctgctgcggatcttcgatcttctcatcctataagattgggttt |
4887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 3898784 - 3898713
Alignment:
| Q |
1 |
ctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattattttgtcttacaaggctgcacagg |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3898784 |
ctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattatcttgtcttacaaggctgcacagg |
3898713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 166 - 232
Target Start/End: Complemental strand, 3897297 - 3897231
Alignment:
| Q |
166 |
gttgtgattgtttgaaggatattgctacggcggatcttcgatcttctcatcctataagattgggttt |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3897297 |
gttgtgattgtttgaaggatattgctgcggcagatcttcgatcttctcatcctataagattgggttt |
3897231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 46283500 - 46283571
Alignment:
| Q |
1 |
ctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattattttgtcttacaaggctgcacagg |
72 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
46283500 |
ctgagtttaagattggtgatgagaaaaaatctgctgctgaggatactatgttgtcttacaaagctgcacagg |
46283571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 46283646 - 46283698
Alignment:
| Q |
180 |
aaggatattgctacggcggatcttcgatcttctcatcctataagattgggttt |
232 |
Q |
| |
|
|||||||||||| | |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
46283646 |
aaggatattgctgctgcggatcttccatcaactcatcctataagattgggttt |
46283698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University