View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_high_50 (Length: 249)
Name: NF15296_high_50
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_high_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 36441411 - 36441190
Alignment:
| Q |
5 |
ctcccttcccgattcatctccccacccaaacagtttgccgccctagcatgctctatcatctccccatcacactttcagccaccaacaatcactattttgt |
104 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36441411 |
ctcccttccagattcatttccccacccaaacagtttgccgccctagcatgctctatcatctccccatcacactttcagccaccaaccatcactattttgt |
36441312 |
T |
 |
| Q |
105 |
gagatattgctcataaaaaggtttatcgtggtagtttatgcagaaaaggataaaaatggaaattcaagaaacataagcatttctcgctcatttcttcgct |
204 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36441311 |
gagatattgctcataaagaggtttatcgtggtagtttatgcagaaaaggataaaaatggaaattcaagaaacataagcatttctcgctcatttcttcgct |
36441212 |
T |
 |
| Q |
205 |
gcatagaggagaccatgaaaaa |
226 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
36441211 |
gcatagagaagaccatgaaaaa |
36441190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University