View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_high_51 (Length: 247)
Name: NF15296_high_51
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_high_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 5 - 230
Target Start/End: Complemental strand, 12699489 - 12699264
Alignment:
| Q |
5 |
gatcgacaactttatatcaatgttgctctgacaattatacctttatggtcggttcacacggctgatcaagatgatgctgagtccaggttcaatttggtga |
104 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12699489 |
gatcgacaactttatagcagcgttgctctgacaattatacctttatggtcggttcacaccgctgatcaagatgatgctgactccaggttcaatttggtga |
12699390 |
T |
 |
| Q |
105 |
caaggcaattttgcggtggcagccaccatggcgttgtcatgttaaatgaaatgttgacgcatctttctttgatcaactaaaagaacaagtatatgcactt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12699389 |
caaggcaattttgcggtggcagccaccatggcgttgtcgtgttaaatgaaatgttgacgcatctttctttgatcaactaaaagaacaagtatatgtactt |
12699290 |
T |
 |
| Q |
205 |
gtatccgggacaaggaaggaactttt |
230 |
Q |
| |
|
||||||| ||| |||||||||||||| |
|
|
| T |
12699289 |
gtatccgtgacgaggaaggaactttt |
12699264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University