View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_high_62 (Length: 216)
Name: NF15296_high_62
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_high_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 41151976 - 41152152
Alignment:
| Q |
17 |
cataggagatgggcaagatgttctagtaagagtgcattcagaatgtttaactggggatatatttggatcagctcggtgtgactgtggccagcaactagat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41151976 |
cataggagatgggcaagatgttctagtaagagtgcattcagaatgtttaactggggatatatttggatcagctcggtgtgactgtggccagcaactagat |
41152075 |
T |
|
| Q |
117 |
ttggctatggaattgattgaagaagctggaagaggagtaattgtttatcttagaggtcatgaaggaagaggcattgg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41152076 |
ttggctatggaattgattgaagaagctggaagaggagtaattgtttatcttagaggtcatgaaggaagaggcattgg |
41152152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University