View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_high_64 (Length: 205)
Name: NF15296_high_64
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_high_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 19 - 123
Target Start/End: Complemental strand, 2226875 - 2226771
Alignment:
| Q |
19 |
cacagatatatcacaatttcaagattcataccacataaagtaaagaaactgggccactgaaaactagtgcaacagaaaaattagatagtaaatgcatcta |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2226875 |
cacagatatatcacaatttcatgattcataccacataaagtaaagaaactgggccactgaaaactagtgcaacagaaaaattagatagtaaatgcatcta |
2226776 |
T |
 |
| Q |
119 |
aaact |
123 |
Q |
| |
|
||||| |
|
|
| T |
2226775 |
aaact |
2226771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University