View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_high_8 (Length: 551)
Name: NF15296_high_8
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 18 - 537
Target Start/End: Original strand, 33780000 - 33780538
Alignment:
| Q |
18 |
tatcgttatgtcatttcttaactttgtgattttatcaatctcaccactcattcaaacatacaattaa-ctatatagcacatgttgcacggcctttgaatc |
116 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33780000 |
tatcgttatgtcatttcttaactttatgattttatcaatctcaccactcatccaaacatacaattaaactatatagcacatgttgcacggcctttgaatc |
33780099 |
T |
 |
| Q |
117 |
tgaacacataggttcactcatatacttaggatgtcacattgtcactcgcttttgcctcaatcactcacttgaccgtggcccttaggtggagagtagtgta |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33780100 |
tgaacacatagggtcactcatatacttaggatgtcacattgtcactcgcttttgcctcaatcactcacttgaccgtggcccttaggtggagagtagtgta |
33780199 |
T |
 |
| Q |
217 |
ccttatatttgtgctagctagagaaaagagaaattgtagtatagagtataaccttaatttgtgtgctgtcgcacaatgaaagggtgagacactaaagtta |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33780200 |
ccttatatttgtgctagctagagaaaagagaaattgtagtatagagtataaccttaattggtgtgctgtcgcacaatgaaagggtgagacactaaagtta |
33780299 |
T |
 |
| Q |
317 |
ggggtatgtgtggggtttcagaatcagaggcaa---------------aaactgccactaattgc------atgcaaatgcaaatgcaatgcaatccagt |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33780300 |
ggggtatgtgtggggtttcagaatcagaggcaaacactgtctctggctacactgccactaattgcatgcaaatgcaaatgcaaatgcaatgcaatccagt |
33780399 |
T |
 |
| Q |
396 |
cctccatatagtgagtgagggcagaggagaagnnnnnnnnnnnnnnnnnnngctaatgtaagtgctcccacttctctttatcccacgctgcatatcactc |
495 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33780400 |
cctccatatagtgagtgagggcagaggagaag---actactactactactagctaatgtaagtgctcccacttctctttatcccacgctgcatatcactc |
33780496 |
T |
 |
| Q |
496 |
acgtcatttctcttgattctcctttctatattaccttgtttc |
537 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33780497 |
acgtcatttctcttgattctcctttctatattaccttgtttc |
33780538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University