View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_low_45 (Length: 266)
Name: NF15296_low_45
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 41796610 - 41796793
Alignment:
| Q |
18 |
aaagggacttagtttgatatatcccttttgcagagacaaacatcaatatgggtgagatctttgaggatacttccaaattgggtaggactaactcacaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41796610 |
aaagggacttagtttgatatatcccttttgcagagagcaacatcaatatgggtgagatctttgaggatacttccaaattgggtaggactaactcacaaca |
41796709 |
T |
 |
| Q |
118 |
caatagctgcatcacagtagtaaactctagaattcgcaatccctatagttgacacatcgataattgttggatcaaaatcagatc |
201 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41796710 |
caatagctacatcacagtagtaaactctagaattcgcaatccctatagttgacacattgataattgttggatcaaaatcagatc |
41796793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 41792904 - 41792982
Alignment:
| Q |
18 |
aaagggacttagtttgatatatcccttttgcagagacaaacatcaatatgggtgagatctttgaggatacttccaaatt |
96 |
Q |
| |
|
|||||||||| ||||||| |||| |||||| ||||| ||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
41792904 |
aaagggactttgtttgatctatcacttttgtagagagcaacatcaatgtggatgagatctttgaggatacttccaaatt |
41792982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 115
Target Start/End: Original strand, 41789961 - 41790049
Alignment:
| Q |
27 |
tagtttgatatatcccttttgcagagacaaacatcaatatgggtgagatctttgaggatacttccaaattgggtaggactaactcacaa |
115 |
Q |
| |
|
||||||||| | ||||||||| ||||| ||||||||| ||||||||||||| |||||||| |||||||| || ||||| |||||||| |
|
|
| T |
41789961 |
tagtttgatctttcccttttgtagagagcaacatcaatgtgggtgagatcttagaggatacatccaaatttcgtgggacttactcacaa |
41790049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 41762635 - 41762723
Alignment:
| Q |
18 |
aaagggacttagtttgatatatcccttttgcagagacaaacatcaatatgggtgagatctttgaggatacttccaaattgggtaggact |
106 |
Q |
| |
|
|||||||||||||||||| | ||||||||| ||| | ||||||||| ||| ||||||||| ||||| |||| ||||| ||| ||||| |
|
|
| T |
41762635 |
aaagggacttagtttgatctttcccttttgtagatagcaacatcaatgtggatgagatcttagaggaaacttttaaattcggtgggact |
41762723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University