View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_low_48 (Length: 257)
Name: NF15296_low_48
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 6 - 243
Target Start/End: Original strand, 4388342 - 4388580
Alignment:
| Q |
6 |
catctcaaggaaaaaacaataaagcaagtgtcactgtttcggtttactcttcatgggatctatgacttggcaaaggaagctataaggagattggatgaca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4388342 |
catctcaaggaaaaaacaataaagcaagtgtcactgtttcggtttactcttcatgggatctatgacttggcaaaggaagctataaggagattggatggca |
4388441 |
T |
|
| Q |
106 |
aaattgttgaggaagacgactaaattgtcaattaggcaaagtatgatagaaagaagagcattctacatgaaaaacatgatagaaacaccaagagtgg-gg |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4388442 |
aaattgttgaggaagacaactaaattgtcaattaggcaaagtatgatagaaagaagagcattctacatgaaaaacatgatagaaacaccaagagtggtgg |
4388541 |
T |
|
| Q |
205 |
taaattccaagactacatgtcttttaaggatgctttgat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388542 |
taaattccaagactacatgtcttttaaggatgctttgat |
4388580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University