View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15296_low_60 (Length: 236)
Name: NF15296_low_60
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15296_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 52715623 - 52715814
Alignment:
| Q |
19 |
gattccctcattctgcttaattaaaccgttaccgtttttacaagatgtgaattcatctattannnnnnnnnnnnnnnnnatggtgaactgtgtattaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
52715623 |
gattccctcattctgcttaattaaaccgttaccgtttttacaagatgtgaattcatctttt--------ttttttttttatggtgaactgtgtattaaac |
52715714 |
T |
|
| Q |
119 |
tattcatctgttttgtttatgtccctttcaattaatctccaccatcacattactacaacattattatttaataatagtttctcagaaagatctctgctgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
52715715 |
tattcatctgttttgtttatgtcccttttaattaatctcca-catcacattactacaacattattatttaataatagtttctgagaaagatctttgctgc |
52715813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University