View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15296_low_64 (Length: 226)

Name: NF15296_low_64
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15296_low_64
NF15296_low_64
[»] chr4 (1 HSPs)
chr4 (7-226)||(53789720-53789939)


Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 53789939 - 53789720
Alignment:
7 ggtgggaatggtggtcgacgggttatgcagtaagtgattcagtgggaaggttaagacacggcaatccgggcgatcatattggactagtgctaggttcctg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53789939 ggtgggaatggtggtcgacgggttatgcagtaagtgattcagtgggaaggttaagacacggcaatccgggcgatcatattggactagtgctaggttcctg 53789840  T
107 ttcggcgttgatcgctgaaggtgcactgtgacgaatttgggatcggagatgagggaattccaagacttattcaaatactttaattgcaacaaagatttca 206  Q
    |||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||    
53789839 ttcggcgttgatagctgaaggtgcaatttgacgaatttgggatcggagatgagggaattccaagacttattcacacactttaattgcaacaaagatttca 53789740  T
207 ctggaagcaatgatagaact 226  Q
    ||||||||||||||||||||    
53789739 ctggaagcaatgatagaact 53789720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University