View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15296_low_67 (Length: 216)

Name: NF15296_low_67
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15296_low_67
NF15296_low_67
[»] chr2 (1 HSPs)
chr2 (17-193)||(41151976-41152152)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 41151976 - 41152152
Alignment:
17 cataggagatgggcaagatgttctagtaagagtgcattcagaatgtttaactggggatatatttggatcagctcggtgtgactgtggccagcaactagat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41151976 cataggagatgggcaagatgttctagtaagagtgcattcagaatgtttaactggggatatatttggatcagctcggtgtgactgtggccagcaactagat 41152075  T
117 ttggctatggaattgattgaagaagctggaagaggagtaattgtttatcttagaggtcatgaaggaagaggcattgg 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41152076 ttggctatggaattgattgaagaagctggaagaggagtaattgtttatcttagaggtcatgaaggaagaggcattgg 41152152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University