View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15297_high_13 (Length: 253)
Name: NF15297_high_13
Description: NF15297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15297_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 26 - 196
Target Start/End: Complemental strand, 2465701 - 2465531
Alignment:
| Q |
26 |
caaatataccaataacacgaattgaagcaaactaagctagaaaaccccaaaatgtgtgacttaccgccgaacagaacaaatcaaccaaactccaccaaag |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2465701 |
caaatataccaataacacgaattgaagcaaactaagctagaaaaccccaaaatgtgtgacttaccaccgaacagaacaaatcaaccaaactccaccaaag |
2465602 |
T |
 |
| Q |
126 |
aagaggattgccagaagcgatgacagtcgttgaaggaaccgaaccaaggaggttcaatttctgttcatcgt |
196 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2465601 |
aagaggattgccagaagcgaggacagtcgttgaaggaaccgaaccaaggaggttcaattgctgttcatcgt |
2465531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University