View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15297_high_5 (Length: 433)
Name: NF15297_high_5
Description: NF15297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15297_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 17 - 109
Target Start/End: Original strand, 33525818 - 33525913
Alignment:
| Q |
17 |
tcactcttctgctgcaaccttt-agactcacattcaaggcaaaataaatta--cccatctgcaaccttcaaacccacattctaaatacaatcagac |
109 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525818 |
tcactcttctgctgcaaccttttagactcacattcaaggcaaaataaattatacccatctgcaaccttcaaacccacattctaaatacaatcagac |
33525913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University