View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15297_low_12 (Length: 323)
Name: NF15297_low_12
Description: NF15297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15297_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 45 - 311
Target Start/End: Original strand, 1601502 - 1601768
Alignment:
| Q |
45 |
gatattagggttctctctgctcgtctcaaaatcctttgaaattcttcaagcaaagcttcatgctatcaaaaacttttattggctaaggagctgaactacc |
144 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1601502 |
gatattagggttctctcggctcgtctcaaaatcctttgaaattcttcaagcaaagcttcatgctatcaaaaacttttattggctaagcagctgaactacc |
1601601 |
T |
 |
| Q |
145 |
atgaggtgatttgcactacaaactctgtttagtgtgttgacatcctccatgttcaaacttcaatattccacaaatttgctacttttatctaaaatgtcaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1601602 |
atgaggtgatttgcactacaaactctgtttagtgtgttgacatcctccatgttcaaacttcaatattccacaaatttgctacttttatctaaaatgtcaa |
1601701 |
T |
 |
| Q |
245 |
agatcttcttaatcaagatcacggccgttccttgtcatgcctcaattatttatagggatatgagtat |
311 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1601702 |
agatcttcttaatcaagatcagggccgttccttgtcatgcctcaattatttatagggatatgagtat |
1601768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University