View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15297_low_15 (Length: 268)
Name: NF15297_low_15
Description: NF15297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15297_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 783088 - 783324
Alignment:
| Q |
18 |
acagactaccatatttagttgctaatgttagaacatttcccgtagtaatagtaacttacttattgagcattgttgcatatcgatgttggagcttaattca |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783088 |
acagattaccatatttagttgctaatgttagaacatttcccgtagtaatagtaacttacttattgagcattgttgcatatcgatgttggagcttaattca |
783187 |
T |
|
| Q |
118 |
tttggtggcaggtttcatatgggatattagagaaagtgtcacctgtgacacactcagtcggaaattgtgttaagcgtgtcgttgtcatcgtctcttctgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
783188 |
tttggtggcaggtttcatatgggatattagagaaagtgtcacctgtgacacactcagtcggaaattgcgttaagcgtgtcgttgtcatcgtctcttctgt |
783287 |
T |
|
| Q |
218 |
tatcttcttccaaactcctgtctcacctatcaatgcc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783288 |
tatcttcttccaaactcctgtctcacctatcaatgcc |
783324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University