View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15297_low_22 (Length: 209)
Name: NF15297_low_22
Description: NF15297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15297_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 1982056 - 1982233
Alignment:
| Q |
16 |
cagagaaagggcagagatcgacgatgatggtggctgagttttgagcagattcagttgcttcaatggtggattcaatgacttcaattgcggcagagacatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1982056 |
cagagaaagggcagagatcgacgatgatggtggctgagttttgagcagattcagttgcttcaatggtggattcaatgacttcaattgcagcagagacatc |
1982155 |
T |
 |
| Q |
116 |
atagttgtgttgtgtggtggtgccttcggcggtggcgttgaagtggtgttgtcatgtggtttcttaaaaggtgttact |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1982156 |
atagttgtgttgtgtggtggtgccttcggcggtggcgttgaagtggtgttgtcatgtggtttcttaaaaggcgttact |
1982233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 78
Target Start/End: Original strand, 37089542 - 37089594
Alignment:
| Q |
26 |
gcagagatcgacgatgatggtggctgagttttgagcagattcagttgcttcaa |
78 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
37089542 |
gcagagattaacgatggtggcggctgagttttgagcagattcagtcgcttcaa |
37089594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University