View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15297_low_7 (Length: 433)

Name: NF15297_low_7
Description: NF15297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15297_low_7
NF15297_low_7
[»] chr1 (1 HSPs)
chr1 (17-109)||(33525818-33525913)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 17 - 109
Target Start/End: Original strand, 33525818 - 33525913
Alignment:
17 tcactcttctgctgcaaccttt-agactcacattcaaggcaaaataaatta--cccatctgcaaccttcaaacccacattctaaatacaatcagac 109  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||    
33525818 tcactcttctgctgcaaccttttagactcacattcaaggcaaaataaattatacccatctgcaaccttcaaacccacattctaaatacaatcagac 33525913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University