View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15298_high_12 (Length: 283)
Name: NF15298_high_12
Description: NF15298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15298_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 25585797 - 25586055
Alignment:
| Q |
1 |
attagtggagcatctgatcccttactttcttctatagttgtcatcgatgtacataaaaaacagctggtctcataataattgagaaatatttcaca--gcc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25585797 |
attagtggagcatctgatcccttactttcttctatagttgtctgcaatgtacataaaaaacagctggtctcataataattgagaaatatttcacacagct |
25585896 |
T |
|
| Q |
99 |
gaagaaattcttaggtatttattcaactaactaatggtagcaatggctgttgatgtaggtagattttctctaattggaatggattgaaataaaagagcca |
198 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25585897 |
gaagaaactcttaggtatttattcaactaactaatgctagcaatggctgttgatgtaggtagattttctctaattggaatggattgaaataaaagagcca |
25585996 |
T |
|
| Q |
199 |
ttctgaattttgtctagtgaaaatcttccagatttcaatgctttagatatgggtcagag |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25585997 |
ttctgaattttgtctagtgaaaatcttccagatttcaatgctttagatatgggtcagag |
25586055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 25600332 - 25600373
Alignment:
| Q |
1 |
attagtggagcatctgatcccttactttcttctatagttgtc |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25600332 |
attagtggagcatctgatcccttactttcttcgatagttgtc |
25600373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 25590680 - 25590721
Alignment:
| Q |
1 |
attagtggagcatctgatcccttactttcttctatagttgtc |
42 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
25590680 |
attagtggagcatctgatcccttactttcctcgatagttgtc |
25590721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University