View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15298_low_22 (Length: 201)
Name: NF15298_low_22
Description: NF15298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15298_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 90 - 143
Target Start/End: Original strand, 16859155 - 16859208
Alignment:
| Q |
90 |
tctgttgtgtctttgtttgacaaggacaagagtgttagacaatagacatgcctt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16859155 |
tctgttgtgtctttgtttgacaaggacaagtgtgttagacaatagacatgcctt |
16859208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 143 - 184
Target Start/End: Original strand, 16859420 - 16859461
Alignment:
| Q |
143 |
tggaacagcaccaccccttgatttgggttcactcccgcaact |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16859420 |
tggaacagcaccaccccttgatttgggttcactcccgcaact |
16859461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University