View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_high_33 (Length: 360)
Name: NF15299_high_33
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 325; Significance: 0; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 28341226 - 28341566
Alignment:
| Q |
1 |
aaggtcggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgtaagctatagctactatgatgatgtgggaaatagggtgtttaattttaa |
100 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28341226 |
aaggtcggggttcaaacctcaggtaccccacttctccacatttaaaatgtgtaagctatagctactatgatgatgtgggaaatagggtgtttaattttaa |
28341325 |
T |
 |
| Q |
101 |
cattgaaacctttcaggatgataaagttagtaatggaaaaattggtatgaaggttattatggttgatgtaaggagaagtttctgctatgataaggttgat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28341326 |
cattgaaacctttcaagatgataaagttagtaatggaaaaattggtatgaaggttattatggttgatgtaaggagaagtttctgctatgataaggttgat |
28341425 |
T |
 |
| Q |
201 |
agtaaaattaggtttgatggctctattgttgaatctattttggtttttgcaataccaaatgacagagatgcaattggtgatggtagcaaaaatgaaatat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28341426 |
agtaaaattaggtttgatggctctattgttgaatctattttggtttttgcaataccaaatgacagagatgcaattggtgatggtagcaaaaatgaaatat |
28341525 |
T |
 |
| Q |
301 |
ttgcattgatgtgaccaatttctattgcaaagtttcaagac |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28341526 |
ttgcattgatgtgaccaatttctattgcaaagtttcaagac |
28341566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 3 - 62
Target Start/End: Original strand, 23233999 - 23234058
Alignment:
| Q |
3 |
ggtcggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgtaagctatagc |
62 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||| ||||||| |||| |||| |
|
|
| T |
23233999 |
ggtcggggttcgaaccccagacaccctacttctccacatttataatgtgtgagctctagc |
23234058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 3 - 57
Target Start/End: Original strand, 41998396 - 41998450
Alignment:
| Q |
3 |
ggtcggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgtaagct |
57 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||||||||||||||| |||| |
|
|
| T |
41998396 |
ggtcggggttcgaaccctagacaccctacttctccacatttaaaatgtgtgagct |
41998450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 6 - 57
Target Start/End: Original strand, 13105142 - 13105193
Alignment:
| Q |
6 |
cggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgtaagct |
57 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||||||||||| |||| |
|
|
| T |
13105142 |
cggggttcgaacctcagacaccccacttctccacatttaaaatgtgtgagct |
13105193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 3 - 57
Target Start/End: Original strand, 34873134 - 34873188
Alignment:
| Q |
3 |
ggtcggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgtaagct |
57 |
Q |
| |
|
|||||||||||||||||| | |||| |||||| |||||||||||||||| |||| |
|
|
| T |
34873134 |
ggtcggggttcgaacctcggacaccccacttctccacatttaaaatgtgtgagct |
34873188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 3 - 57
Target Start/End: Complemental strand, 36035201 - 36035147
Alignment:
| Q |
3 |
ggtcggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgtaagct |
57 |
Q |
| |
|
|||||||||||||||||| | |||| |||||| |||||||||||||||| |||| |
|
|
| T |
36035201 |
ggtcggggttcgaacctcggacaccccacttctccacatttaaaatgtgtgagct |
36035147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 26261300 - 26261255
Alignment:
| Q |
7 |
ggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgt |
52 |
Q |
| |
|
|||||||||||||||| || || |||||||||| |||||||||||| |
|
|
| T |
26261300 |
ggggttcgaacctcagatatcccacttcttcacgtttaaaatgtgt |
26261255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 25672422 - 25672368
Alignment:
| Q |
1 |
aaggtcggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgtaag |
55 |
Q |
| |
|
||||| || |||| |||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
25672422 |
aaggttggagttcaaacctcagacaccctacttcttcacatttataatgtgtaag |
25672368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 51
Target Start/End: Complemental strand, 19647414 - 19647373
Alignment:
| Q |
10 |
gttcgaacctcaggtaccctacttcttcacatttaaaatgtg |
51 |
Q |
| |
|
||||||||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
19647414 |
gttcgaacctcggataccctacttcttcatatttaaaatgtg |
19647373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 52
Target Start/End: Complemental strand, 30209023 - 30208974
Alignment:
| Q |
3 |
ggtcggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgt |
52 |
Q |
| |
|
|||||||||||||||||| || |||| |||||| || ||||||||||||| |
|
|
| T |
30209023 |
ggtcggggttcgaacctcgggcaccccacttctccatatttaaaatgtgt |
30208974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 9 - 57
Target Start/End: Original strand, 36422549 - 36422597
Alignment:
| Q |
9 |
ggttcgaacctcaggtaccctacttcttcacatttaaaatgtgtaagct |
57 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| || |||||| |||| |
|
|
| T |
36422549 |
ggttcgaacctcagatacactacttcttcacattaaatatgtgtgagct |
36422597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 3 - 67
Target Start/End: Complemental strand, 42381135 - 42381071
Alignment:
| Q |
3 |
ggtcggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgtaagctatagctacta |
67 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| |||| ||||| ||||| |||| |||| |||| |
|
|
| T |
42381135 |
ggtcggggttcgaacctcagacaccccacttctccacaattaaattgtgtgagctttagccacta |
42381071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 3 - 67
Target Start/End: Original strand, 47929293 - 47929357
Alignment:
| Q |
3 |
ggtcggggttcgaacctcaggtaccctacttcttcacatttaaaatgtgtaagctatagctacta |
67 |
Q |
| |
|
||||| |||||||||||| | |||| |||||| |||||||||||||||| |||| |||| |||| |
|
|
| T |
47929293 |
ggtcgaggttcgaacctcggaaaccccacttctccacatttaaaatgtgtgagctctagccacta |
47929357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University