View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_high_44 (Length: 293)
Name: NF15299_high_44
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 24 - 158
Target Start/End: Original strand, 12551140 - 12551275
Alignment:
| Q |
24 |
tctagggttcggaaatattctaaacaccactgtgagtaaatcatcgaatctcttgttcaagagactaagaaaattgcaggtattaggg-tgtatggttga |
122 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||| |
|
|
| T |
12551140 |
tctagggttcgaaaatattctaaacacctctgtgagtaaatcatcgaatctcttgttcaagagactaagaaaattgcaggtattagggttttattgttga |
12551239 |
T |
 |
| Q |
123 |
cggattatttttaataattcttgtatctcttcgtaa |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12551240 |
cggattatttttaataattcttgtatctcttagtaa |
12551275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 244 - 278
Target Start/End: Original strand, 12551280 - 12551314
Alignment:
| Q |
244 |
atgtttttcttttcttttatcttatcttattattg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12551280 |
atgtttttcttttcttttatcttatcttattattg |
12551314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University