View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_high_49 (Length: 272)
Name: NF15299_high_49
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_high_49 |
 |  |
|
| [»] scaffold0301 (1 HSPs) |
 |  |  |
|
| [»] scaffold0292 (1 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
| [»] scaffold0664 (1 HSPs) |
 |  |  |
|
| [»] scaffold0490 (1 HSPs) |
 |  |  |
|
| [»] scaffold1544 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 9e-39; HSPs: 17)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 22379413 - 22379312
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22379413 |
ttcattaggggagagtacactaggaataggttgggaatgcccaactttagattcaacaccttctgaaaaggttttggcatagtcccccttttctttcttg |
22379314 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
22379313 |
ta |
22379312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 22564755 - 22564855
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
22564755 |
ttcattagtggagagtacactaggaataggttgggaatgcaaaactttagatttaaca-cttttgaaaaggttttggtatattctcccttttctttcttg |
22564853 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
22564854 |
ta |
22564855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 3192085 - 3192186
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||| |||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
3192085 |
ttcattagaggagagtacactacgaatatgttgggaatacccaactttagatttaacacattttgaaaagatttaggtatagtctcccttttctttcttg |
3192184 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
3192185 |
ta |
3192186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 162 - 252
Target Start/End: Original strand, 22564924 - 22565013
Alignment:
| Q |
162 |
gagtttaaagatggtaaacatattgtgtatagcaacaatacacactcaaccaatcaaattccacaattttgacactatcatattacaattt |
252 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
22564924 |
gagtttaaagatggtaaacagattgtgtatagcaattatacacactcaaccaatcaaattccacaattttgacac-atcattttacaattt |
22565013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 27608076 - 27608178
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttg-aaaaggttttggtatagtcccccttttctttctt |
99 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||| ||| || |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
27608076 |
ttcattaggggagagtacactaggaataggctgggaatgcccaactttagattcaacaccttctgaaaaacgttttggcatagtcccccttttctttctt |
27608175 |
T |
 |
| Q |
100 |
gta |
102 |
Q |
| |
|
||| |
|
|
| T |
27608176 |
gta |
27608178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 4 - 102
Target Start/End: Complemental strand, 24185581 - 24185483
Alignment:
| Q |
4 |
attagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||| || || ||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24185581 |
attaggggagagtacattaggaataggttgggtatgcccaatttcaggtttaacaacttttgaaaaggttttggttcggtcccccttttctttcttgta |
24185483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 3 - 102
Target Start/End: Original strand, 33527690 - 33527789
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||| |||||||| |||||| ||||| | ||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
33527690 |
cattagagaagagtacaataggaacaggttagatatgcccaactttagatttactaccttttgaaaaggttttggtatagtctcccttttcttttttgta |
33527789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 10194098 - 10194003
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttcttt |
96 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| | |||| ||| || |||||||||| |||||||||||||||||||||||||| || ||||||| |
|
|
| T |
10194098 |
ttcattaggggagagtacaataggaataggttagaaatgttcaatttcagatttaacaccttttgaaaaggttttggtatagtcctccgtttcttt |
10194003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 3191848 - 3191921
Alignment:
| Q |
29 |
ggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||| |||||| ||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
3191848 |
ggttggaaatgcctaactttaaatttaacatcttttgaaaaggttttggtatagtttcccttctctttcttgta |
3191921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 34427114 - 34427013
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttg |
100 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||| ||||| || | |||||||| ||||| |||| |||||||| |||||| ||||||||| ||| |
|
|
| T |
34427114 |
ttcattaagggagagtacaataggaataggttgggaatacccaatttcaaatttaacaccttttaaaaaagttttggtttagtccttcttttcttttttg |
34427015 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
34427014 |
ta |
34427013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 38903783 - 38903873
Alignment:
| Q |
12 |
agagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggt-tttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| || ||||||| ||||| ||||||||| |||||| |||| |||||||||||||||||| |
|
|
| T |
38903783 |
agagtacactatgaataggttgggcatgcccaatttcagatttattatcttatgaaaaggtatttggtctagt-ccccttttctttcttgta |
38903873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 17596070 - 17595988
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagt |
83 |
Q |
| |
|
||||||||| ||| |||||| | |||| |||||||||||| || || |||||||||| ||||| |||||||||||||||||| |
|
|
| T |
17596070 |
ttcattagaatagattacactggaaataagttgggaatgcctaatttcagatttaacaccttttaaaaaggttttggtatagt |
17595988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 24 - 75
Target Start/End: Complemental strand, 41214262 - 41214211
Alignment:
| Q |
24 |
gaataggttgggaatgcccaactttagatttaacatcttttgaaaaggtttt |
75 |
Q |
| |
|
||||||||||||||||||||||||||||| | || |||||||||||||||| |
|
|
| T |
41214262 |
gaataggttgggaatgcccaactttagatacatcaccttttgaaaaggtttt |
41214211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 19381453 - 19381351
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggta-tagtcccccttttctttctt |
99 |
Q |
| |
|
|||||||| || |||||||||||||||| |||||| ||| ||||| |||||||| | ||| | |||||||||||| | | |||||||| ||||||||| |
|
|
| T |
19381453 |
ttcattaggggggagtacactaggaataagttgggcatgttcaactatagatttacaaccttctcaaaaggttttggcatttgtccccctattctttctt |
19381354 |
T |
 |
| Q |
100 |
gta |
102 |
Q |
| |
|
||| |
|
|
| T |
19381353 |
gta |
19381351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 13346721 - 13346804
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtc |
84 |
Q |
| |
|
|||||||| || ||||||| ||| ||||| |||||||| || || |||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
13346721 |
ttcattaggggtgagtacattagaaatagtttgggaatacctaattttagattcttcaacttttcaaaaggttttggtatagtc |
13346804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 17556001 - 17555948
Alignment:
| Q |
46 |
tttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttctt |
99 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||||||||| || |||||| |
|
|
| T |
17556001 |
tttagatttgtcaacttttgaagaggttttggtatagtccccctcttttttctt |
17555948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 112 - 144
Target Start/End: Original strand, 3191938 - 3191970
Alignment:
| Q |
112 |
atctaatgaaatggtgcatctgcatctgtttat |
144 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3191938 |
atctaatgaaatgatgcatctgcatctgtttat |
3191970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 19196022 - 19195920
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttgg-tatagtcccccttttctttctt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| | || |||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
19196022 |
ttcattagaggagagtacactaggaataggttgggtatgcccaactttagattcaccaccttttgaaaaggttttggctttagtcccccttttctttctt |
19195923 |
T |
 |
| Q |
100 |
gta |
102 |
Q |
| |
|
||| |
|
|
| T |
19195922 |
gta |
19195920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 3 - 95
Target Start/End: Original strand, 14723381 - 14723473
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctt |
95 |
Q |
| |
|
||||||||||||||||| || ||| |||||||| ||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14723381 |
cattagaggagagtacaataagaacaggttgggtatgcccaactttaaatttactatctttcgaaaaggttttggtatagtcccccttttctt |
14723473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 18921212 - 18921131
Alignment:
| Q |
21 |
taggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| |||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
18921212 |
taggaataggttgggaatgtccaattttagatttaacaccttttgaaaaggttttagcgtagtcccccttttctatcttgta |
18921131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 94
Target Start/End: Complemental strand, 14774924 - 14774843
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttct |
94 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| | | || ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14774924 |
gagtacaataggaataggttgggtatgcccaactttaggtatgtcaccttttgaaaaggttttggtttagtcccccttttct |
14774843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 3 - 92
Target Start/End: Complemental strand, 28184459 - 28184370
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtccccctttt |
92 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||| |||| | |||||||||| ||||||||| ||||||||||| |
|
|
| T |
28184459 |
cattagaggagagtacaataggaataggttgggtatgcccaactttaaattttctaccttttgaaaaatttttggtatggtccccctttt |
28184370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 31451676 - 31451595
Alignment:
| Q |
21 |
taggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| |||||||||||||||| | |||||||| |||||| ||||||| |
|
|
| T |
31451676 |
taggaataggttgggaatggccaattttagatttaacaccttttgaaaaggttttagcctagtccccattttctatcttgta |
31451595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 12658269 - 12658174
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttcttt |
96 |
Q |
| |
|
|||||||| |||||||| | ||||||| |||||| |||| |||| || | |||||||| ||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
12658269 |
ttcattaggggagagtatattaggaatgggttggcaatgtccaaattcaaatttaacaccttttaaaaaggttttggtataatcccccttttcttt |
12658174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 13 - 87
Target Start/End: Original strand, 11306432 - 11306506
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccc |
87 |
Q |
| |
|
||||||| |||||||||||| || |||||||||||||| | | || ||||||||||||||||||| | |||||| |
|
|
| T |
11306432 |
gagtacaataggaataggttaggtatgcccaactttaggtatgtcaccttttgaaaaggttttggtttggtcccc |
11306506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0301 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: scaffold0301
Description:
Target: scaffold0301; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 4975 - 4874
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||| |||||||||||||||| || |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4975 |
ttcattaggggagagtacactaggaataggctgggaatgcctaactttagatttaacactttctgaaaaggttttggcatagtcccccttttctttcttg |
4876 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
4875 |
ta |
4874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 3 - 102
Target Start/End: Complemental strand, 11673567 - 11673468
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11673567 |
cattagaggagagtacactagaaataggttgggaatgcccaactttagattctgcaccttttgaaaaggttttggttcggtcccccttttctttcttgta |
11673468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 3 - 102
Target Start/End: Original strand, 55468934 - 55469032
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| ||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
55468934 |
cattagaggagagtacaataggaatagattgggtatgcccaactttagatttactaccttttgaaaaggttttggtatag-cccccttttcttttttgta |
55469032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 94
Target Start/End: Original strand, 8500211 - 8500292
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttct |
94 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||| || ||||||||||||| ||||| || |||||||||||| |
|
|
| T |
8500211 |
gagtacattaggaataggttggaaatgcccaactttagatttaccaccttttgaaaaggtcttggtctaatcccccttttct |
8500292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 9047500 - 9047443
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaaca |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9047500 |
ttcattagaggagagtacactaggaataggttgagaatgcccaactttagatttaaca |
9047443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 43096203 - 43096102
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttg |
100 |
Q |
| |
|
|||||||| |||||||||| || ||||||||||| |||||||| || || ||||||| || |||||||||||||||| | |||||||||||||||||| |
|
|
| T |
43096203 |
ttcattaggggagagtacatcagaaataggttgggtatgcccaatttcaggtttaacacctattgaaaaggttttggtttgatcccccttttctttcttg |
43096104 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
43096103 |
ta |
43096102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 13 - 95
Target Start/End: Original strand, 9217766 - 9217847
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctt |
95 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||| | | |||||||||||| |||||| | |||||||||||||| |
|
|
| T |
9217766 |
gagtacaataggaataggttgggaatgcccaattttagatatgtaaccttttgaaaagg-tttggtttggtcccccttttctt |
9217847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 94
Target Start/End: Original strand, 48710746 - 48710827
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttct |
94 |
Q |
| |
|
||||||| ||||||||||||||| | |||||||||||| | | | |||||||||||||||| || | ||||||||||||| |
|
|
| T |
48710746 |
gagtacaataggaataggttgggtaggcccaactttaggtatgttaccttttgaaaaggttttagtttggtcccccttttct |
48710827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 96
Target Start/End: Original strand, 27449219 - 27449299
Alignment:
| Q |
16 |
tacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttcttt |
96 |
Q |
| |
|
|||| |||||||| |||||| ||||||||||||| || | || |||||||||||||| |||| | |||| |||||||||| |
|
|
| T |
27449219 |
tacaataggaatatgttgggtatgcccaactttaaatatgccaccttttgaaaaggttctggtgttgtcctccttttcttt |
27449299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 96
Target Start/End: Original strand, 7578623 - 7578716
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttcttt |
96 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7578623 |
cattagaggagagtgcaataggaataggttgggtatgcccaactttagatttactaccttttgaaaaggttttggtatagtcccctttttcttt |
7578716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 9701517 - 9701618
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttg |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||| || |||||||||| | ||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
9701517 |
ttcattagaggagagtacaataggaataggttgggtatgccaaaatttagatttactaccttttgaaaagattttggtatagtcccccttttcttttttg |
9701616 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
9701617 |
ta |
9701618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 3 - 102
Target Start/End: Original strand, 31136838 - 31136937
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||||||||| |||||| ||||| || ||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
31136838 |
cattagaggagagtacaataggaacaggttaggtatgcccaactttagatttactaccttttgaaaaggttttggtatagtctcccttttcttttttgta |
31136937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 4 - 102
Target Start/End: Original strand, 14960387 - 14960485
Alignment:
| Q |
4 |
attagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||| || || |||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14960387 |
attaggggagagtacattaggaataggttgggtatgcccaatttcaggtttaacgtcttttgaaaaggttttggttcggtcccccttttctttcttgta |
14960485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 27537926 - 27538019
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttct |
94 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| || | |||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27537926 |
ttcattagaggagagtacactaagaataggttgggcttgcccaatttcaaattttgtaccttttgaaaaggttttggtatagtcccccttttct |
27538019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 22721216 - 22721115
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttg |
100 |
Q |
| |
|
||||| || |||||||||| |||||||||||||| |||||||| || || ||||||| || |||||||||||||||| | |||||||||||||||| || |
|
|
| T |
22721216 |
ttcataaggggagagtacatcaggaataggttgggtatgcccaatttcaggtttaacacctattgaaaaggttttggtttggtcccccttttctttcctg |
22721117 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
22721116 |
ta |
22721115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 91
Target Start/End: Complemental strand, 1344191 - 1344109
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttt |
91 |
Q |
| |
|
||||||||||||||||| |||||| |||||| | ||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1344191 |
cattagaggagagtacaataggaacaggttgagtatgccaaactttact------atcttttgaaaaggttttggtatagtcccccttt |
1344109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 27 - 92
Target Start/End: Complemental strand, 41517829 - 41517764
Alignment:
| Q |
27 |
taggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtccccctttt |
92 |
Q |
| |
|
||||||||||||||| || || |||||| || |||||||||||||||||||||||||| |||||| |
|
|
| T |
41517829 |
taggttgggaatgcctaatttcagattttgcaacttttgaaaaggttttggtatagtcctcctttt |
41517764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 94
Target Start/End: Complemental strand, 13598842 - 13598773
Alignment:
| Q |
25 |
aataggttgggaatgcccaactttagatttaacatcttttgaa-aaggttttggtatagtcccccttttct |
94 |
Q |
| |
|
|||||||| ||||||||||||||||| |||| | |||||| || |||||||||||||| ||| |||||||| |
|
|
| T |
13598842 |
aataggttaggaatgcccaactttaggtttatc-tctttttaagaaggttttggtataatcctccttttct |
13598773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 102
Target Start/End: Original strand, 29859829 - 29859865
Alignment:
| Q |
66 |
aaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29859829 |
aaaaggttttggcctagtcccccttttctttcttgta |
29859865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 48920966 - 48921051
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtccc |
86 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
48920966 |
ttcattagaggagagtacaataggaacaggttgggtatgcccaactttagatttactaccttttgaaaaggttttggtatagtccc |
48921051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 102
Target Start/End: Original strand, 22634787 - 22634879
Alignment:
| Q |
10 |
ggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
22634787 |
ggagagtacattaggaataggttgggaatgcccaactttagatttaccaccttctgaaaaggttttggtctaatcccccttttccatcttgta |
22634879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 3 - 102
Target Start/End: Original strand, 34428461 - 34428560
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| |||||||||||||| | ||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
34428461 |
cattagaggagagtacaataggaacaggttgggtatgtccaactttagattttctaccttttgaaaaggttttggtatggtcccccttttcttttttgta |
34428560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 4 - 102
Target Start/End: Complemental strand, 19280667 - 19280569
Alignment:
| Q |
4 |
attagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||| |||||||||| |||||||| |||||| |||||||| || || ||||||| ||||| ||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
19280667 |
attaggggagagtacattaggaatatgttgggtatgcccaatttcaggtttaacaccttttaaaaaggttttggtttggtcccccttttctttcttgta |
19280569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 45992411 - 45992512
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttg |
100 |
Q |
| |
|
|||||||| |||||||||| ||||||| |||||| |||||||| || |||||||||| || |||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
45992411 |
ttcattaggggagagtacatcaggaataagttgggtatgcccaatttcagatttaacacctattgaaaaggttttggtttggtccctcttttctttcttg |
45992510 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
45992511 |
ta |
45992512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 4 - 102
Target Start/End: Original strand, 40679159 - 40679257
Alignment:
| Q |
4 |
attagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||| || | |||||| |||||||| |||||||||||||||||| | ||||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
40679159 |
attagaggagattataataggaacaggttgggtatgcccaactttagattttctaccttttgaaaaggttttggtttggtcccccttttcttttttgta |
40679257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 186 - 252
Target Start/End: Complemental strand, 19795315 - 19795250
Alignment:
| Q |
186 |
gtgtatagcaacaatacacactcaaccaatcaaattccacaattttgacactatcatattacaattt |
252 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
19795315 |
gtgtatagcaactatacacactcaaccaatcaaaatccacaattttgacac-atcatatttcaattt |
19795250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 12213181 - 12213255
Alignment:
| Q |
4 |
attagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggt |
78 |
Q |
| |
|
||||| |||||||||| |||||||| |||||| |||||||| | || ||||||||||||||||||||||||||| |
|
|
| T |
12213181 |
attaggggagagtacattaggaatatgttgggtatgcccaatatcaggtttaacatcttttgaaaaggttttggt |
12213255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 4 - 76
Target Start/End: Complemental strand, 46262277 - 46262205
Alignment:
| Q |
4 |
attagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttg |
76 |
Q |
| |
|
|||||||||||| ||| |||||||| ||||| ||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
46262277 |
attagaggagaggacattaggaatatattgggtatgcccaacttcagattcaacaccttttgaaaaggttttg |
46262205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0292 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0292
Description:
Target: scaffold0292; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 102
Target Start/End: Complemental strand, 21657 - 21565
Alignment:
| Q |
10 |
ggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
21657 |
ggagagtacattaggaataggttgggaatgcccaactttagatttaccaccttctgaaaaggttttggtctaatcccccttttccatcttgta |
21565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 102
Target Start/End: Complemental strand, 23467 - 23375
Alignment:
| Q |
10 |
ggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||| || ||||||||||||||||||| || ||||| |||||||| ||||| |
|
|
| T |
23467 |
ggagagtacattaggaataggttgggaatacccaactttagatttaccaccttttgaaaaggttttggtctaatcccctttttcttttttgta |
23375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 5e-25; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 4 - 102
Target Start/End: Original strand, 10012870 - 10012968
Alignment:
| Q |
4 |
attagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||| || || ||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10012870 |
attaggggagagtacattaggaataggttgggtatgcccaatttcaggtttaacaccttttgaaaaggttttggttcggtcccccttttctttcttgta |
10012968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 37247096 - 37247191
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttcttt |
96 |
Q |
| |
|
|||||||| ||||| |||||||||||| |||||| |||| |||| || | ||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37247096 |
ttcattaggggagaatacactaggaattggttggaaatgtccaatttcatattcaacatcttttgaaaaggttttggtatagtctcccttttcttt |
37247191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 3 - 102
Target Start/End: Original strand, 19921174 - 19921273
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| |||||||||||||| | ||||||||||||||||| | | ||||||||||||||| ||||| |
|
|
| T |
19921174 |
cattagaggagagtacaataggaacaggttgggtatgtccaactttagattttctaccttttgaaaaggttttgatttggtcccccttttcttttttgta |
19921273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 13 - 94
Target Start/End: Original strand, 580553 - 580634
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttct |
94 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| | | || ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
580553 |
gagtacaataggaataggttgggtatgcccaactttaggtatgtcaccttttgaaaaggttttggtttggtcccccttttct |
580634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 45088712 - 45088812
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttg |
100 |
Q |
| |
|
||||||| |||||||||| | | ||||||||||| ||||| | ||| ||||||||||||||||||||||||||||||||| |||||||| || ||||| |
|
|
| T |
45088712 |
ttcattacgggagagtacatttgaaataggttgggtatgcctgattttcgatttaacatcttttgaaaaggttttggtatag-ccccctttgctatcttg |
45088810 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
45088811 |
ta |
45088812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 36585699 - 36585781
Alignment:
| Q |
20 |
ctaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||| || ||||||| || || || ||| ||| |||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
36585699 |
ctaggaataggatgagaatgcctaatttcaggttttacaccttttgaaaaggttttggtacagtcccccttttctttattgta |
36585781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 10 - 102
Target Start/End: Original strand, 28603681 - 28603773
Alignment:
| Q |
10 |
ggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||| |||| ||||| | |||||| ||||||| ||| || ||| || ||||||||||||| |
|
|
| T |
28603681 |
ggagagtacattaggaataggttgggaatgtccaattttaaatttatctcattttgagaaggtttaggtttaatcctccctttctttcttgta |
28603773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 51
Target Start/End: Original strand, 20534828 - 20534866
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttaga |
51 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
20534828 |
gagtacattaggaacaggttgggaatgcccaactttaga |
20534866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 13 - 74
Target Start/End: Original strand, 13043293 - 13043354
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttt |
74 |
Q |
| |
|
||||||| |||||||||||||||| | ||||||||||||| | | ||||||||||||||| |
|
|
| T |
13043293 |
gagtacaataggaataggttgggattacccaactttagatatgtaaccttttgaaaaggttt |
13043354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 4 - 102
Target Start/End: Original strand, 43984 - 44082
Alignment:
| Q |
4 |
attagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||| || || ||||||| ||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
43984 |
attaggggagagtacattaggaataggttgggtatgcccaatttcaggtttaacaccttttgaaaaggttttggttcggccccccttttctttcttgta |
44082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 7e-21; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 3 - 102
Target Start/End: Original strand, 7705815 - 7705914
Alignment:
| Q |
3 |
cattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||||||||||||| || ||| ||||||| ||||||||||||| ||||| || |||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
7705815 |
cattagaggagagtacaataagaacaggttggatatgcccaactttaaatttactatattttaaaaaggttttggtatagtccccattttcttttttgta |
7705914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 64 - 102
Target Start/End: Complemental strand, 34493476 - 34493438
Alignment:
| Q |
64 |
tgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34493476 |
tgaaaaggttttggtatagtcctccttttctttcttgta |
34493438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 35 - 92
Target Start/End: Original strand, 26268339 - 26268395
Alignment:
| Q |
35 |
gaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtccccctttt |
92 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26268339 |
gaatgcccaattttagattctctatcttttgaaaaggttttggtatag-ccccctttt |
26268395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 69
Target Start/End: Complemental strand, 17238735 - 17238679
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaa |
69 |
Q |
| |
|
||||||| |||||||| || ||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
17238735 |
gagtacattaggaataagtcgggtatgcccaactttagatttattaccttttgaaaa |
17238679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 112 - 144
Target Start/End: Complemental strand, 34493420 - 34493388
Alignment:
| Q |
112 |
atctaatgaaatggtgcatctgcatctgtttat |
144 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
34493420 |
atctaatgaaatgatgcatctgcatctgtttat |
34493388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 10 - 102
Target Start/End: Original strand, 62832 - 62924
Alignment:
| Q |
10 |
ggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||||| ||| ||||||||||||| |||||||||||||||| | ||| ||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
62832 |
ggagagtacattagaaataggttgggaaaacccaactttagatttactaccttatgaaaaggtcttggtttattcccccttttctttcttgta |
62924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0664 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: scaffold0664
Description:
Target: scaffold0664; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 2170 - 2244
Alignment:
| Q |
4 |
attagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggt |
78 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||| || || ||||||| ||||||||||||||||||| |
|
|
| T |
2170 |
attaggggagagtacattaggaataggttgggtatgcccaatttcaggtttaacaccttttgaaaaggttttggt |
2244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0490 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: scaffold0490
Description:
Target: scaffold0490; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 13 - 102
Target Start/End: Original strand, 10215 - 10304
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttgg-tatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||| |||||| || |||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
10215 |
gagtacaataggaataggttgggtatgcccaacttcagatttgtcaccttttgaaaaggttttggctaga-tcccccttttctttcttgta |
10304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1544 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold1544
Description:
Target: scaffold1544; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 1240 - 1333
Alignment:
| Q |
1 |
ttcattagaggagagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttct |
94 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| || || ||| | ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
1240 |
ttcattagaggagagtacactaagaataggttgggcttgcccaatttcaggttttgtaccttttgaaaaggttttggttttgtcccccttttct |
1333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 94
Target Start/End: Complemental strand, 23616913 - 23616832
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttct |
94 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||| || | | || ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
23616913 |
gagtacaataggaataggttgggtatgcccaacttcaggtatgtcaccttttgaaaaggttttggtttggtcccccttttct |
23616832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 94
Target Start/End: Complemental strand, 23848312 - 23848231
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttct |
94 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||| || | | || ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
23848312 |
gagtacaataggaataggttgggtatgcccaacttcaggtatgtcaccttttgaaaaggttttggtttggtcccccttttct |
23848231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 102
Target Start/End: Original strand, 4151842 - 4151919
Alignment:
| Q |
25 |
aataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||||| ||| |||| || || ||||||| || |||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
4151842 |
aataggttggatatgtccaatttcaggtttaacacctattgaaaaggttttggtttggtcccccttttctttcttgta |
4151919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 102
Target Start/End: Original strand, 38622938 - 38623026
Alignment:
| Q |
13 |
gagtacactaggaataggttgggaatgcccaactttagatttaacatcttttgaaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
||||||| ||||||||| ||||||||| |||||||||||| | | |||||||||||| |||||| | | ||||||||||||| ||||| |
|
|
| T |
38622938 |
gagtacaataggaatagattgggaatgtccaactttagatatgtaaccttttgaaaagg-tttggtttggccccccttttcttttttgta |
38623026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 102
Target Start/End: Complemental strand, 23138489 - 23138453
Alignment:
| Q |
66 |
aaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23138489 |
aaaaggttttggcctagtcccccttttctttcttgta |
23138453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 102
Target Start/End: Complemental strand, 26229333 - 26229297
Alignment:
| Q |
66 |
aaaaggttttggtatagtcccccttttctttcttgta |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26229333 |
aaaaggttttggcctagtcccccttttctttcttgta |
26229297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University