View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_high_53 (Length: 260)
Name: NF15299_high_53
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_high_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 46892454 - 46892706
Alignment:
| Q |
1 |
cttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccaccgttggtatccgaccgccttggaaacgcgtcgttaccgactgccaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892454 |
cttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccaccgttggaatccgaccgccttggaaacgcgtcgttaccgactgccaga |
46892553 |
T |
 |
| Q |
101 |
ttgttcagttcgtgttcagcttcgccgtctccggtctcatgctttattatcacttcggatccgatggtggtggatgctctgggatgaaggcttggtgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46892554 |
ttgttcagttcgtgttcagcttcgccgtctccggtctcatgctttattatcacttcggatccgatggtggtggatgctgtgggatgaaggcttggtgttt |
46892653 |
T |
 |
| Q |
201 |
caatgctgtttttaatgcttctcttttggctctttttcttgattttcatctca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892654 |
caatgctgtttttaatgcttctcttttggctctttttcttgattttcatctca |
46892706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University