View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_high_58 (Length: 238)
Name: NF15299_high_58
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_high_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 41 - 225
Target Start/End: Original strand, 23923743 - 23923928
Alignment:
| Q |
41 |
aatgtatcaaatgtatttatctacttgtatttctaggataaaatttcttcaatgaacacaattaatgatagccaccgctactnnnnnnn-tcagaatggt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23923743 |
aatgtatcaaatgtatttatctacttgtatttctaggataaaatttcttcaatgaacacaattaatgatagccaccgctactaaaaaaaatcagaatggt |
23923842 |
T |
|
| Q |
140 |
atggtccaagaaatagaaaagaaagaaacaagtgtgagtcacgaggatcgaaattggaaaggcccactgtacatgaaaaattgtct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23923843 |
atggtccaagaaatagaaaagaaagaaacaaatgtgagtcacgaggatcgaaattggaaaggcccactgtacatgaaaaattgtct |
23923928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University