View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_high_62 (Length: 227)
Name: NF15299_high_62
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_high_62 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 9432 - 9621
Alignment:
| Q |
16 |
tatccaatttcttaacagatggaatcagtgtaatgtgtaacatgcttctagttaaacaagnnnnnnntaactttgtgaaacg-cccatccctactgattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
9432 |
tatccaatttcttaacagatggaatcagtgtaatgtgtaacatgcttctagttaaacaagaaaaaaataactttgtggaacgccccatccctactgattg |
9531 |
T |
 |
| Q |
115 |
aattctcatattgtagcagacaatgttttacatacnnnnnnntatacacggaagaaacaattagcttttcttatatgataagtacaatat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9532 |
aattctcatattgtagcagacaatgttttacatacaaaaaattatacacggaagaaacaattagcttttcttatatgataagtacaatat |
9621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University