View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_high_70 (Length: 218)
Name: NF15299_high_70
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_high_70 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 38421745 - 38421975
Alignment:
| Q |
1 |
ttttgtaccatttctattttcttgtggcatgcttgaatctttgaaagctgtatacaatgaaaggaccagtgttgtcgatggtggactgcaaagagcc--- |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38421745 |
ttttgtaccatttctattttcttgtggcatgctttaatctttgaaagctgtatacaatgaaaggaccagtgttgtcgatggtggactgcaaagagccaaa |
38421844 |
T |
 |
| Q |
98 |
-----gcgataatggc-aacacgttgcaccaccatatccgagtatggc----accgtggcgccactattcttcacaaaattggccatgacggaaagacag |
187 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38421845 |
aacccgcgataatggccaacacgttgcaccaccatatccgagtatggatggtaccgtggcgccactattcttcacaaaattggccatgacggaaagacag |
38421944 |
T |
 |
| Q |
188 |
aatcccacaaccaatatctgtcatggccgat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38421945 |
aatcccacaaccaatatctgtcatggccgat |
38421975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 38414621 - 38414699
Alignment:
| Q |
1 |
ttttgtaccatttctattttcttgtggcatgcttgaatctttgaaagc-tgtatacaatgaaaggaccagtgttgtcga |
78 |
Q |
| |
|
||||| ||||| ||| |||| |||||| |||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
38414621 |
ttttgaaccatctcttttttgttgtggtatgcttgaatctttgaaagcttgaatacaatgaaaggaccagtgttgtcga |
38414699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University