View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_low_13 (Length: 487)
Name: NF15299_low_13
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 8e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 8e-90
Query Start/End: Original strand, 25 - 248
Target Start/End: Original strand, 33730898 - 33731122
Alignment:
| Q |
25 |
tggtggtagttggacttcaatatgtatgaaaaaacaccttatggtgatgacaaaagttctttgggagcattgatgcatagttccatgaaagtttcaaaaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33730898 |
tggtggtagttggacttcaatatgtatgaaaaaacaccttatggtgatgacaaaagtgctttaggagcattgatgcatagttccatgaaagtttcaaaaa |
33730997 |
T |
|
| Q |
125 |
ggttttcaacaatctcctc-annnnnnnactaatggaggggagtcacgaagtttctctttttcattttcaattttgttatgtttactgtcactactatcc |
223 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33730998 |
ggttttcaacaatctcctctttttttttactaatggaggggagtcacgaaatttctctttttcattttcaatttttttatgtttactgtcactactatcc |
33731097 |
T |
|
| Q |
224 |
ttatcctcgtgatcttcctaaggtt |
248 |
Q |
| |
|
||||| || |||||||||||||||| |
|
|
| T |
33731098 |
ttatcttcatgatcttcctaaggtt |
33731122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University